IJE Advance Access originally published online on July 25, 2005
International Journal of Epidemiology 2005 34(5):1110-1117; doi:10.1093/ije/dyi131
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Published by Oxford University 2005
Article |
Correlates of Human Herpesvirus-8 DNA detection among adults in Italy without Kaposi sarcoma
1 Viral Epidemiology Branch, Division of Cancer Epidemiology and Genetics, National Cancer Institute, National Institutes of Health, DHHS, Rockville, MD, USA
2 Johns Hopkins Bloomberg School of Public Health, Baltimore, MD, USA
3 Viral Epidemiology Section, AIDS Vaccine Program, SAIC-Frederick, NCI-Frederick, Frederick, MD, USA
4 Dipartimento di Igiene e Microbiologia 'Giuseppe D'Alessandro', Universitá degli studi di Palermo, Palermo, Italy
5 San Gallicano Hospital, Roma, Italy
6 Ospedale dei BambiniARNAS Servizio analisi Chimico-Cliniche, Palermo, Italy
7 Dipartimento di Epidemiologia, Istituto Nazionale Malattie Infettive L. Spallanzani, IRCCS, Rome, Italy
8 Departimento di Scienze Biomediche, Universitá degli studi di Catania, Catania, Italy
9 Lega Italiana per la lotta contro i tumorisez. Ragusa, Ragusa, Italy
* Corresponding author. National Cancer Institute, 6120 Executive Blvd., EPS 8005/MSC 7248 Rockville, MD 20852, USA. E-mail: brownbe{at}mail.nih.gov
| Abstract |
|---|
|
|
|---|
Background The presence of Human Herpesvirus-8 (HHV8) DNA is predictive of Kaposi sarcoma (KS) among patients with HIV-associated or iatrogenic immunosuppression. However, correlates of HHV8-DNA detection in the general population remain undefined.
Methods We assessed correlates of HHV8-DNA detection among Italian adults without KS who had antibodies against HHV8-latent nuclear antigen by immunofluorescence assay. HHV8-K6 DNA sequences were detected in peripheral blood mononuclear cells using TaqMan PCR.
Results Of the 158 subjects 26 (16.5%) had detectable HHV8-DNA [median copies/million cells, 53; (132128)]. Adjusted for age, sex, and laboratory, HHV8-DNA was detected more frequently in participants with >7 total residents in the childhood home [OR = 3.7 (1.59.1)], >2 younger siblings [OR = 2.6 (1.16.5)], and current cardiovascular [OR = 3.6 (1.39.7)] or renal [OR = 3.1 (1.28.0)] disease. Excluding the participants using immune modulating drugs, HHV8-DNA was more frequent among those with low red blood cells (RBC) [<4.5 106/µl; OR = 5.3 (1.716.2)], slightly elevated mean corpuscular volume [>92 µm3/red cell; OR = 2.8 (1.07.8)], and mild thrombocytopenia [<151 K/µl; OR = 5.6 (1.916.3)].
Conclusions Presence of HHV8-DNA in elderly Italians is associated with childhood crowding, low RBCs, and platelets, perhaps indicating roles for early infection and chronic inflammation. These risk factors are the first to be reported for non-immunosuppressed HHV8-seropositive adults.
Keywords HHV8, Kaposi sarcoma herpesvirus, KSHV, viral DNA, viral load
Accepted 3 June 2005
Since its discovery,1 Human Herpesvirus-8 (HHV8) has been consistently detected in all clinical variants of Kaposi sarcoma (KS)2,3 including classic (CKS),4 endemic,5 iatrogenic,6 and AIDS-associated forms.2,3,7 HHV8, also known as Kaposi sarcoma-associated Herpesvirus (KSHV), is a necessary cause of KS but additional cofactors are required for the pathogenesis of this vascular malignancy of lymphatic endothelial origin.1
HHV8 seroprevalence is increased among populations at risk for HIV-1 infection8 and among solid organ transplant recipients.911 In the general population, the seroprevalence of HHV8 demonstrates regional variability irrespective of the type of assay used.12 Among blood donors from Northern Europe, the detection of HHV8 antibodies against latent nuclear antigen (LANA) and open reading frame 65 is infrequent, ranging between 3 and 5%.13,14 In contrast, seroprevalence to these antibodies is generally higher in Southern Europe, ranging from 2 to 35%,1521 with the highest frequency reported in southern Italy.16 In Italy, the distribution of HHV8 geometric mean titres recapitulates the northsouth gradient, with persons seropositive for HHV8-LANA exhibiting higher viral titres in the south (geometric mean HHV8 antibody titre, 11 631) compared with their northern counterparts (geometric mean HHV8 antibody titre, 455).16
The transmission of HHV8 infection is not well defined. Serologic studies suggest that it occurs sexually8,2127 and by alternative horizontal routes, possibly through saliva28,29 and blood products.24 HHV8 transmission in endemic areas begins in childhood15,19,3033 and the seroprevalence increases with age to
50 years,34 suggesting that transmission can occur throughout life.
Following seroconversion, infection with HHV8 is life-long and may alternate between a lytic and a latent lifecycle.35 It is not known whether the presence of viral DNA sequences in peripheral blood mononuclear cells (PBMCs) is a result of the reactivation and replication of HHV8 or an expansion of latently infected B cells. Nonetheless, among patients with HIV-associated or iatrogenic immunosuppression, the presence of PBMC HHV8-DNA is predictive of KS.36 However, correlates of PBMC viral DNA detection in HHV8-infected individuals, who may be at heightened risk for this malignancy, remain undefined. Therefore, we examined correlates of DNA sequence detection among healthy HHV8-seropositive controls in a casecontrol study of CKS in Italy, an area endemic for HHV8.
| Methods |
|---|
|
|
|---|
Study population
Controls from the Italian Kaposi sarcoma casecontrol study (KCC) manifesting anti-HHV8 LANA were used to assess correlates for the detection of HHV8-DNA in PBMCs.37 As previously published,37 we enrolled 192 healthy subjects without KS but with evidence of HHV8 latent antibodies. Questionnaire information and PBMC DNA adequate for the HHV8 viral load amplification were available from 158 (82.3%) of these subjects.
All the subjects were healthy volunteers
18 years of age without evidence for KS or HIV-1 infection. They were identified through sampling the patient populations of collaborating local primary care physicians from Sicily as well as mainland sites in Rome and Naples between April 1998 and October 2001. Subjects were screened for HHV8-LANA antibodies.37 Those testing seropositive by immunofluorescence (IFA) were invited to provide informed consent and enrolled in the KCC.
Data collection
At enrollment, trained personnel obtained the questionnaire data and blood samples from all subjects. Information from questionnaires included demographic, occupational, sexual, medical and family histories, personal hygiene, and alcohol and cigarette use.
Laboratory methods
As previously described,37 antibodies against HHV8-LANA were detected in a 1:120 dilution of sera by IFA, using the BCBL-1 cell line without tetradecanoyl phorbol-ester acetate induction.34 Specimens with punctate nuclear immunofluorescence were considered seropositive.
HHV8-DNA load was determined in PBMCs using a quantitative real-time polymerase chain reaction assay. PBMCs were frozen and stored in liquid nitrogen until tested. DNA was extracted from PBMCs using the QIAmp DNA blood kit (Qiagen Inc. Valencia, CA) and the number of copies of HHV8-DNA determined according to the standard procedure.3841 Quantitative real-time amplifications were performed in triplicate against the HHV8 K6 gene using the primers 5'-CGCCTAATAGCTGCTGCTACGG-39 and 59-TGCATCAGCTG CCTAACCCAG-3' and the probe 5'-CACCCACCGCCCGTCCAAATTC-3' on an ABI Prism 7700 (P.E. Biosystems, Foster City, CA). The number of HHV8 copies detected in triplicate samples were averaged and normalized to the number of PBMCs (copies/106 cells), as determined by parallel quantification of the human ERV-3 gene, using the primers 5'-CATGGGAAGCAAGGGAACTAATG-3' and 5'-CCCAGCGAGCAATACAGAATTT-3', and the labelled probe 5'-(FAM) TCTTCCCTCGAACCTGCACCATCAAGTCA(TAMARA)-3'.42 The lower limit of detection for HHV8 was three copies per million PBMC.
Complete blood counts were performed using the standard protocol. Proportions of peripheral blood T-lymphocyte subsets (helper/inducer and suppressor/cytotoxic) were estimated using flow cytometry on fresh whole blood and monoclonal antibodies for CD4 and CD8, respectively. Absolute numbers of T-lymphocyte subpopulations were estimated as the product of total lymphocytes, from the complete blood count, and the respective T-lymphocyte proportions. All blood studies were analysed at the time of study enrollment in centralized laboratories in Sicily (Dipartimento di Igiene e Microbiologia 'Giuseppe D'Alessandro', Universitá degli studi di Palermo) and Central Italy (Laboratorio di Epidemiologia e Biostatistica, Istituto Superiore di Sanitá, Rome).
Ethical considerations
Institutional Review Boards from each study site reviewed and approved the protocol, the questionnaire, and related materials prior to initiation.
Statistical analysis
Using a cross-sectional approach, we investigated correlates of HHV8-DNA present in PBMCs either due to primary infection or viral reactivation. Based on the distribution among subjects without detectable HHV8-DNA, age was divided into tertiles (
70, 7177, and >77 years of age). Potential differences by geography were examined by collapsing the study site into north (Central Italy) and south (Sicily) to correspond with centralized processing laboratories. Initially, median values of blood cell parameters among subjects without evidence of viral DNA were used to define high and low categories. Based on statistically significant associations with detectable PBMC HHV8-DNA, red blood cells (RBCs) and platelets were examined further by using cutoffs above and below the 15th percentile, a threshold that allowed adequately sized comparison groups while approximating the clinical significance. Detectable HHV8-DNA was dichotomized into two categories, present or absent, where values <10 copies per 106 cells were considered absent and values
10 copies per 106 cells were considered present. To minimize misclassification, the one study subject who had eight viral DNA copies per 106 cells detected was excluded from our analyses. To evaluate correlates of the HHV8-DNA load, three ordered categories of HHV8-DNA levels were defined as undetectable, low [median 30 copies per million PBMC (range 1378)], and high [median 157 copies per million PBMC (range 1272128)], with the high group corresponding to above the 75th percentile. Quartiles were chosen based on graphical examination of the data.
The presence of viral DNA sequences in PBMCs was estimated by the prevalence odds ratio (OR) and the corresponding 95% confidence interval (CI) calculated by the use of logistic regression.43 Tests for statistical significance of trend were conducted using multiple logistic regression with median levels of the HHV8-DNA load per category as a continuous variable. All estimates were adjusted for potential confounders including age, sex, and the processing laboratory unless otherwise specified. For each variable of interest, final models were selected by comparing the goodness of fit
2 for models that included selected additional potential confounders and interaction terms. Statistical significance, based on multivariate logistic models, was calculated with the maximum conditional likelihood test and
2. Stratified analyses were used to assess haematologic correlates of HHV8-DNA independent of the processing laboratory. All statistical tests were two-sided. All analyses were conducted in STATA version 7.0 (College Station, TX).
| Results |
|---|
|
|
|---|
Of the 158 HHV8-seropositive adults without CKS included in this investigation, the majority were male (70%) and from Sicily (79%). The median age did not significantly differ by sex [mean = 73 years (range 3792) for males and mean = 74 years (range 4490) for females]. Overall, 26 (16.5%, 95% CI 10.622.3%) participants had HHV8-DNA detected in PBMCs. The median level of HHV8-DNA detected in PBMCs was 53 copies/106 cells (range 132128 copies/106 cells). Detection of HHV8-DNA was not statistically significantly different by sex, age (mean = 76 years, HHV8-DNA+ and 72 years, HHV8-DNA), or the processing laboratory (Table 1). Consistent with the complete study population, the majority of patients with evidence of PBMC HHV8-DNA were male (65.4%) and from Sicily (73.1%).
|
The prevalence of HHV8-DNA was higher among persons with current lower socioeconomic status. Crowding in the childhood home, particularly those whose childhood home had more than seven total residents (OR = 3.7, 95% CI 1.59.1), more than two younger siblings (OR = 2.6, 95% CI 1.16.5), and increasing number of total siblings (P-trend = 0.04, Table 2) were associated with detection of PBMC HHV8-DNA. Compared with fewer younger siblings, having more than two younger siblings was associated not only with the detection of PBMC HHV8-DNA but also with high levels of HHV8-DNA (>126 copies/106 cells; OR = 4.5, 95% CI 1.118.1; P-trend = 0.008). Likewise, participants with more than seven residents in their childhood homes were more likely to have high levels of viral DNA (OR = 6.4, 95% CI 1.625.2) compared with those with fewer residents (P-trend = 0.04).
|
As shown in Table 2, analyses of current personal hygiene habits, cigarette smoking, and alcohol consumption did not reveal statistically significant associations with HHV8-DNA detection. Among men, the total number of lifetime sex partners did not support a strong association with the detection of PBMC HHV8-DNA. Four women reported more than one lifetime sex partner, of whom three had detectable viral DNA (OR = 29.5, 95% CI 2.2388). No participant had a history of thalassemia or other haemoglobinopathy. Among participants with cardiovascular or renal disease (Table 3), the probability of detecting HHV8-DNA was statistically elevated (OR = 3.6, 95% CI 1.39.7 and OR = 3.1, 95% CI 1.28.0, respectively). Prior or current users of corticosteroids were not statistically significantly more likely to have detectable PBMC HHV8-DNA than non-users (OR = 1.1, 95% CI 0.52.6), including separate evaluations for each route of administration (P > 0.17).
|
We excluded 4 DNA-positive and 17 DNA-negative subjects who used corticosteroids or cancer chemotherapeutics at the time of enrolment for analyses used to examine blood count and T-cell correlates of PBMC HHV8-DNA detection (Table 4). While detection of HHV8-DNA was unrelated to haematocrit and haemoglobin levels (P
0.26), it was more common in subjects with RBC and platelet counts below the median (OR = 3.1, 95% CI 1.09.4; OR = 4.1, 95% CI 1.412.4, respectively) and a mean corpuscular volume (MCV) above the median (OR = 2.8, 95% CI 1.07.8). Only four HHV8-DNA positives had clearly low RBC (<4.2 3 106/ml) or platelet (<100 K/ml) counts precluding our ability to make meaningful conclusions from this analysis. However, among patients with low RBC or platelet counts (redefined at the 15th percentile: RBC < 4.5 3 106/ml and platelets < 151 K/ml), the likelihood of detecting HHV8-DNA was markedly elevated (OR = 5.3, 95% CI 1.716.2 and OR = 5.6, 95% CI 1.916.3, respectively). Compared with controls, increasing levels of viral load were strongly associated with having low RBC (P-trend = 0.01) and platelet counts (P-trend = 0.02).
|
In contrast, no notable difference in levels of white blood cell parameters, including total leukocytes, total lymphocytes, and corresponding T-cell subpopulations (CD4+ and CD8+ cells), were seen between participants with and without detectable PBMC HHV8-DNA (P
0.91). Similar distributions in the leukocyte differential (neutrophils, basophils, monocytes, and eosinophils) were seen in the two groups (P
0.30). Associations were similar using T-cell subpopulations expressed as percentages of the total lymphocyte population (data not shown). In multivariate analysis, interactions of age and platelets with the processing laboratory were observed (Table 5). After restricting analyses to participants in Sicily and adjusting for age and sex, a history of having greater than seven total residents in the childhood home (OR = 4.0, 95% CI 1.213.8) and platelet and RBC counts below the medians (OR = 5.5, 95% CI 1.323.3 and OR = 8.6, 95% CI 1.742.8, respectively) confirmed significant univariate associations with the detection of PBMC HHV8-DNA. Sparse data from central Italy (n = 4 HHV8-DNA positive cases) prohibited interpretation of multivariate analyses among this group.
|
| Discussion |
|---|
|
|
|---|
We conducted a cross-sectional study among HHV8-LANA seropositive persons to measure correlates of detectable PBMC HHV8-DNA, a known risk factor for KS. Evidence from this study of HHV8-LANA seropositive and HIV-1 seronegative persons suggests that the detection of HHV8-DNA is associated with childhood crowding, low RBC and platelet counts, and a normal or slightly elevated MCV. We found significant independent associations of viral DNA and cardiovascular and renal disease, but the presence of DNA sequences in PBMC was not statistically significantly related to correlates of sexual transmission or with markers of T-cell suppression. To our knowledge, this is the first report on correlates of HHV8-DNA detection among healthy persons with latent HHV8-infection in the absence of KS from an area endemic for HHV8 infection.
The frequency of HHV8-DNA detection in PBMCs (16.5%) is consistent with previous findings of HHV8-DNA in HIV-1 negative Italians without KS (023%).4446 However, the interpretation of published reports is limited because it is not clear whether HHV8-negative individuals, as determined by antibodies against both lytic and latent antigens, were included in the calculation of HHV8-DNA prevalence, which could attenuate estimates and potentially account for the wide range of reported values.
Positive associations of HHV8-DNA associated with large families and, in particular, a close contact with younger children in the childhood home suggest a role for timing of initial infection and risk of high HHV8 viral load as an adult. HHV8 transmission in Italy is not uncommon in childhood,32 and HHV8 seroprevalence increases linearly with age until
50 years.34 Studies in other endemic areas,31 including Israel30 and Africa,47,48 suggest a strong correlation between the HHV8 serostatus of young children and that of their mother, and to a lesser extent, the serostatus of other infected relatives living in the household.48 These reports suggest that close contact in the childhood home and salivary exposure are important for the transmission of HHV8 infection.3033,49,50
Following primary HHV8 infection, levels of both lytic and latent antibodies typically rise together in a linear fashion.51 However, it is not clear whether HHV8-DNA levels change over time relative to the alternating lytic and latent HHV8 lifecycle or in the presence of genetic and environmental factors related to immune competence. The quantification of PBMC HHV8-DNA load among HIV-seropositives is generally 10- to 1000-fold higher than patients without HIV infection.46,52 However, in HIV-seronegative subjects, we did not observe any association between the presence of HHV8-DNA sequences in PBMCs and absolute numbers or percentages of lymphocytes or T-lymphocyte subpopulations, including CD4+ and CD8+ cells.
However, we did detect HHV8-DNA more often in the PBMCs of persons with evidence of low RBCs and normal MCV, perhaps indicative of a mild normocytic anemia (P = 0.02). Anaemia can be indicative of a chronic vascular disease or inflammatory process53 and is, at least in part, due to excessive production of pro-inflammatory cytokines that inhibit the effect of erythropoietin.54 Laboratory evidence from BC-3 and BCBL-1 primary effusion lymphoma B-cell lines presented by Davis et al.,55 suggest that anemia-induced chronic hypoxia increases the expression of lytic HHV8 proteins, consistent with the reactivation of virus. Thus, it is possible that individuals with anaemia are more likely to actively shed HHV8. Consistent with this observation, we detected PBMC HHV8-DNA
three times more often in individuals who typically manifest anaemia, including subjects with cardiovascular (OR = 3.6) or renal disease (OR = 3.1), compared with those in whom these comorbidities were absent.
In addition, we detected HHV8-DNA more often in the PBMCs of persons with low total platelets suggesting that platelets may be involved in the reactivation of HHV8 infection or in a cross-reactivity of antibodies formed in response to HHV8 infection. In a parallel investigation, risk for CKS was increased in persons with a low platelet count after controlling for HHV8-DNA, age, sex, and the processing laboratory (E. E. Brown, unpublished data). Together these findings suggest that platelets may contribute to the disease process either directly in the causal pathway or indirectly as a result of a more generalized inflammatory response possibly precipitated by HHV8 reactivation.56
In summary, childhood crowding, low RBCs, and mild thrombocytopenia were associated with detection of PBMC HHV8-DNA in elderly Italians, indicating a role of early infection and perhaps reflecting the importance of inflammation. While these correlates may be associated with the presence of PBMC HHV8-DNA, either due to primary infection or reactivation, our investigation is limited to cross-sectional interpretation and confirmation is required in a larger, similarly endemic population. These risk factors are the first to be reported for the detection of PBMC HHV8-DNA in healthy HHV8-seropositive adults without KS or HIV-infection.
| Appendix |
|---|
|
|
|---|
Additional investigators and institutions belonging to the Classical Kaposi Sarcoma Working Group include
Nino Romano,1 Francesca Ajello,1 Filippa Bonura,1 Anna Maria Perna,1 Enza Viviano,1 Fabio Tramuto,1 Maria Rosaria Villafrate,1 Maria Antonella Di Benedetto,1 Mario Tamburini,2 Mauizio Montella,2 Anna Crispo,2 Sonia De Sicato,2 Maria Rosaria De Marco,2 Paolo Ascierto,2 Pierluca Piselli,3 Giovanni Rezza,4 Catia Valdarchi,5 Francesca Farchi,5 Rosa Maria Corona,6 Massimo Giuliani,7 Concetta Castilletti,7 Carmela Lauria,8 Caruso Laura,9 Stefania Stella,9 Michele Massimino,9 Barbara Kroner,10 Robert J Biggar11 and Charles S Rabkin11
1 Dipartimento di Igiene e Microbiologia 'Giuseppe D'Alessandro', Universitá degli studi di Palermo, Palermo, Italy.
2 Unità operativa di Epidemiologia, Istituto dei Tumori di Napoli, Fondazione 'G. Pascale', Napoli, Italy.
3 INMI Lazzaro Spallanzani, IRCCS, Roma, Italy.
4 Laboratorio di Epidemiologia e Biostatistica, Istituto Superiore di Sanitá, Rome, Italy.
5 Istituto Superiore di Sanitá, Roma, Italy.
6 Istituto Dermatopatico dell'Immacolata, Roma, Italy.
7 San Gallicano Hospital, Roma, Italy.
8 Lega Italiana per la lotta contro i tumori-sez. Ragusa, Ragusa, Italy.
9 Dipartimento di Scienze Biomediche, Universita degli studi di Catania, Catania, Italy.
10 Research Triangle Institute, Rockville, MD, USA and
11 Viral Epidemiology Branch, National Cancer Institute, Rockville, MD, USA.
| Acknowledgments |
|---|
The authors are grateful to the following organizations and laboratory and field staff members. In Naples, 'Registro Tumori ASL-NA4' and 'Cooperativa Medici e Salute, Pomigliano di'Arco, Napoli'; in Rome, Domenica Tassielli and Giuseppe Ippolito for study facilitation; in western Sicily, Guido Tantillo and Maria Manno (Ospedale dei BambiniARNAS Servizio analisi Chimico-Cliniche) and Maurizio Musso and Ferdinando Porretto (Casa di Cura 'La Maddalena') for flow cytometry; Mario Arico and M. Rita Bongiorno (Universita di PalermoClinica Dermatologica) and Salvatore Amato (Ospedale CivicoARNAS Servizio di Dermatologia) for case ascertainment; in eastern Sicily, Giuseppe Arena and Salvatore Fornaro for phlebotomy; Caterina Martorana, Maria Grazia Ruggeri, Eliana Cavalieri and Mirella Mazza for data collection; the clinical pathology laboratory 'Brinch-Battaglia' of Ragusa; the Director, secretary and drivers of Agenzia Siciliana Trasporti; and the Directors of the histopathology laboratories and departments of Ragusa, Vittoria, Catania, Enna, Caltagirone, Taormina, and Trapani; in Catania, Maryrosa Pilastro (Università Degli Studi di Catania) for specimen processing; in Washington, DC, Rockville, MD, and Buenos Aires, Argentina (Research Triangle Institute), Maryanne Ardini for study management, Daniel Ringer for specimen processing and shipping advice, and Susan Wilson and Liliana Preiss for computer programming. The authors are especially grateful to the research participants and the nearly 100 local primary care physicians for providing population control subjects, without whom this study would not have been possible. This study was supported by the Intramural Research Program of the NCI (contracts N02-CP-91027 with Research Triangle Institute and N01-CO-12400 with SAIC-Frederick); Associazione Italiana Ricerca sul Cancro; Programma Ricerche AIDS, ItalyUS Collaborative Project, Istituto Superiore di Sanita, Italy; and Progetto Nazionale AIDS, Italian Ministry of Health, Istituto Superiore di Sanità, Roma (grant number 20C.15). EEB was supported by the Johns Hopkins University School of Hygiene and Public Health Training Fellowship (CA-0931423) and NCI Office of Cancer Research and Training.
Conflict of Interest: Study sponsors had no role in the study design, data collection, analysis or interpretation, or writing the report. No funding was provided by industry or commercial enterprises.
| Notes |
|---|
Additional coauthors listed in the Appendix. | References |
|---|
|
|
|---|
1 Chang Y, Cesarman E, Pessin MS et al. Identification of herpesvirus-like DNA sequences in AIDS-associated Kaposi's sarcoma. Science 1994;266:186569.
2 Moore PS, Gao SJ, Dominguez G et al. Primary characterization of a herpesvirus agent associated with Kaposi's sarcomae. J Virol 1996; 70:54958.[Abstract]
3 Schalling M, Ekman M, Kaaya EE, Linde A, Biberfeld P. A role for a new herpes virus (KSHV) in different forms of Kaposi's sarcoma. Nat Med 1995;1:7078.[CrossRef][ISI][Medline]
4 Kaposi M. Idiopathisches multiples pigmentsarkom der haut. Arch f Dermat u Syph 1872;4:26573.[CrossRef]
5 Oettle A. Geographical and racial differences in the frequency of Kaposi's sarcoma as evidence of environmental or genetic causes. Acta Unio Int Contra Cancrum 1962;18:33063.[ISI][Medline]
6 Myers BD, Kessler E, Levi J, Pick A, Rosenfeld JB, Tikvah P. Kaposi sarcoma in kidney transplant recipients. Arch Intern Med 1974; 133:30711.[CrossRef][ISI][Medline]
7 Kaposi's sarcoma and Pneumocystis pneumonia among homosexual menNew York City and California. MMWR Morb Mortal Wkly Rep 1981;30:3058.[Medline]
8 Kedes DH, Operskalski E, Busch M, Kohn R, Flood J, Ganem D. The seroepidemiology of human herpesvirus 8 (Kaposi's sarcoma- associated herpesvirus): distribution of infection in KS risk groups and evidence for sexual transmission. Nat Med 1996;2:91824.[CrossRef][ISI][Medline]
9 Regamey N, Tamm M, Wernli M et al. Transmission of human herpesvirus 8 infection from renal-transplant donors to recipients. N Engl J Med 1998;339:135863.
10 Parravicini C, Olsen SJ, Capra M et al. Risk of Kaposi's sarcoma-associated herpes virus transmission from donor allografts among Italian posttransplant Kaposi's sarcoma patients. Blood 1997; 90:282629.
11 Farge D, Lebbe C, Marjanovic Z et al. Human herpes virus-8 and other risk factors for Kaposi's sarcoma in kidney transplant recipients. Groupe Cooperatif de Transplantation d' Ile de France (GCIF). Transplantation 1999;67:123642.[CrossRef][ISI][Medline]
12 Rabkin CS, Schulz TF, Whitby D et al. Interassay correlation of human herpesvirus 8 serologic tests. HHV-8 Interlaboratory Collaborative Group. J Infect Dis 1998;178:3049.[ISI][Medline]
13 Enbom M, Sheldon J, Lennette E et al. Antibodies to human herpesvirus 8 latent and lytic antigens in blood donors and potential high-risk groups in Sweden: variable frequencies found in a multicenter serological study. J Med Virol 2000;62:498504.[CrossRef][ISI][Medline]
14 Regamey N, Cathomas G, Schwager M, Wernli M, Harr T, Erb P. High human herpesvirus 8 seroprevalence in the homosexual population in Switzerland. J Clin Microbiol 1998;36:178486.
15 Calabro ML, Sheldon J, Favero A et al. Seroprevalence of Kaposi's sarcoma-associated herpesvirus/human herpesvirus 8 in several regions of Italy. J Hum Virol 1998;1:20713.[Medline]
16 Whitby D, Luppi M, Barozzi P, Boshoff C, Weiss RA, Torelli G. Human herpesvirus 8 seroprevalence in blood donors and lymphoma patients from different regions of Italy. J Natl Cancer Inst 1998;90:39597.
17 Whitby D, Boshoff C. Kaposi's sarcoma herpesvirus as a new paradigm for virus-induced oncogenesis. Curr Opin Oncol 1998;10:40512.[Medline]
18 Gao SJ, Kingsley L, Li M et al. KSHV antibodies among Americans, Italians and Ugandans with and without Kaposi's sarcoma. Nat Med 1996;2:92528.[CrossRef][ISI][Medline]
19 Rezza G, Lennette ET, Giuliani M et al. Prevalence and determinants of anti-lytic and anti-latent antibodies to human herpesvirus-8 among Italian individuals at risk of sexually and parenterally transmitted infections. Int J Cancer 1998;77:36165.[CrossRef][ISI][Medline]
20 Crispo A, Tamburini M, De Marco MR et al. HHV-8 prevalence, immunosuppression and Kaposi's sarcoma in South Italy. Int J Mol Med 2001;7:53538.[ISI][Medline]
21 Serraino D, Toma L, Andreoni M et al. A seroprevalence study of human herpesvirus type 8 (HHV8) in eastern and Central Africa and in the Mediterranean area. Eur J Epidemiol 2001;17:87176.[CrossRef][ISI][Medline]
22 Martin JN, Ganem DE, Osmond DH, Page-Shafer KA, Macrae D, Kedes DH. Sexual transmission and the natural history of human herpesvirus 8 infection. N Engl J Med 1998;338:94854.
23 Lennette ET, Blackbourn DJ, Levy JA. Antibodies to human herpesvirus type 8 in the general population and in Kaposi's sarcoma patients. Lancet 1996;348:85861.[CrossRef][ISI][Medline]
24 Cannon M, Dollard SC, Smith DK et al. Blood-borne and sexual transmission of human herpesvirus 8 in women with or at risk for human immunodeficiency virus infection. N Engl J Med 2001;344:63743.
25 Perna AM, Bonura F, Vitale F et al. Antibodies to human herpes virus type 8 (HHV8) in general population and in individuals at risk for sexually transmitted diseases in Western Sicily. Int J Epidemiol 2000;29:17579.
26 Greenblatt RM, Jacobson LP, Levine AM et al. Human herpesvirus 8 infection and Kaposi's sarcoma among human immunodeficiency virus-infected and -uninfected women. J Infect Dis 2001;183:113034.[CrossRef][ISI][Medline]
27 Melbye M, Cook PM, Hjalgrim H et al. Risk factors for Kaposi's-sarcoma-associated herpesvirus (KSHV/HHV-8) seropositivity in a cohort of homosexual men, 19811996. Int J Cancer 1998;77:54348.[CrossRef][ISI][Medline]
28 Vitale F, Viviano E, Perna AM et al. Serological and virological evidence of non-sexual transmission of human herpesvirus type 8 (HHV8). Epidemiol Infect 2000;125:67175.[CrossRef][Medline]
29 Pauk J, Huang ML, Brodie SJ et al. Mucosal shedding of human herpesvirus 8 in men. N Engl J Med 2000;9:136977.
30 Davidovici B, Karakis I, Bourboulia D et al. Seroepidemiology and molecular epidemiology of Kaposi's sarcoma- associated herpesvirus among Jewish population groups in Israel. J Natl Cancer Inst 2001;93:194202.
31 Angeloni A, Heston L, Uccini S et al. High prevalence of antibodies to human herpesvirus 8 in relatives of patients with classic Kaposi's sarcoma from Sardinia. J Infect Dis 1998;177:171518.[ISI][Medline]
32 Whitby D, Luppi M, Sabin C et al. Detection of antibodies to human herpesvirus 8 in Italian children: evidence for horizontal transmission. Br J Cancer 2000;82:7024.[CrossRef][ISI][Medline]
33 Bourboulia D, Whitby D, Boshoff C et al. Serologic evidence for mother-to-child transmission of Kaposi sarcoma-associated herpesvirus infection. JAMA 1998;280:3132.
34 Vitale F, Briffa DV, Whitby D et al. Kaposi's sarcoma herpes virus and Kaposi's sarcoma in the elderly populations of 3 Mediterranean islands. Int J Cancer 2001;91:58891.[CrossRef][ISI][Medline]
35 Ganem D. KSHV and Kaposi's sarcoma: the end of the beginning? Cell 1997;91:15760.[CrossRef][ISI][Medline]
36 Engels EA, Biggar RJ, Marshall VA et al. Detection and quantification of Kaposi's sarcoma-associated herpesvirus to predict AIDS-associated Kaposi's sarcoma. Aids 2003;17:184751.[CrossRef][ISI][Medline]
37 Goedert JJ, Vitale F, Lauria C et al. Risk factors for classical Kaposi's sarcoma. J Natl Cancer Inst 2002;94:171218.
38 Whitby D, Howard MR, Tenant-Flowers M et al. Detection of Kaposi sarcoma associated herpesvirus in peripheral blood of HIV-infected individuals and progression to Kaposi's sarcoma. Lancet 1995;346:799802.[CrossRef][ISI][Medline]
39 Little RF, Wyvill KM, Pluda JM et al. Activity of thalidomide in AIDS-related Kaposi's sarcoma. J Clin Oncol 2000;18:2593602.
40 Biggar RJ, Whitby D, Marshall V, Linhares AC, Black F. Human herpesvirus 8 in Brazilian Amerindians: a hyperendemic population with a new subtype. J Infect Dis 2000;181:156268.[CrossRef][ISI][Medline]
41 de Sanjose S, Marshall V, Sola J et al. Prevalence of Kaposi's sarcoma-associated herpesvirus infection in sex workers and women from the general population in Spain. Int J Cancer 2002;98:15558.[CrossRef][ISI][Medline]
42 Yuan CC, Miley W, Waters D. A quantification of human cells using an ERV-3 real time PCR assay. J Virol Methods 2001;91:10917.[CrossRef][ISI][Medline]
43 Hosmer DaL S. Applied Logistic Regression. New York: Wiley; 1989.
44 Luppi M, Barozzi P, Maiorana A et al. Frequency and distribution of herpesvirus-like DNA sequences (KSHV) in different stages of classic Kaposi's sarcoma and in normal tissues from an Italian population. Int J Cancer 1996;66:42731.[CrossRef][ISI][Medline]
45 Cattani P, Capuano M, Lesnoni La Parola I et al. Human herpesvirus 8 in Italian HIV-seronegative patients with Kaposi sarcoma. Arch Dermatol 1998;134:69599.
46 Viviano E, Vitale F, Ajello F et al. Human herpesvirus type 8 DNA sequences in biological samples of HIV-positive and negative individuals in Sicily. AIDS 1997;11:60712.[CrossRef][ISI][Medline]
47 Mayama S, Cuevas LE, Sheldon J et al. Prevalence and transmission of Kaposi's sarcoma-associated herpesvirus (human herpesvirus 8) in Ugandan children and adolescents. Int J Cancer 1998;77:81720.[CrossRef][ISI][Medline]
48 Mbulaiteye SM, Pfeiffer RM, Whitby D, Brubaker GR, Shao J, Biggar RJ. Human herpesvirus 8 infection within families in rural Tanzania. J Infect Dis 2003;187:178085.[CrossRef][ISI][Medline]
49 Plancoulaine S, Abel L, van Beveren M et al. Human herpesvirus 8 transmission from mother to child and between siblings in an endemic population. Lancet 2000;356:106265.[CrossRef][ISI][Medline]
50 Serraino D, Locatelli M, Songini M et al. Human herpes virus-8 infection among pregnant women and their children: results from the Sardinia-IDDM Study 2. Int J Cancer 2001;91:74041.[CrossRef][ISI][Medline]
51 Biggar RJ, Engels EA, Whitby D, Kedes DH, Goedert JJ. Antibody reactivity to latent and lytic antigens to human herpesvirus-8 in longitudinally followed homosexual men. J Infect Dis 2003;187:1218.[CrossRef][ISI][Medline]
52 Bigoni B, Dolcetti R, de Lellis L et al. Human herpesvirus 8 is present in the lymphoid system of healthy persons and can reactivate in the course of AIDS. J Infect Dis 1996;173:54249.[ISI][Medline]
53 Silverberg DS, Iaina A, Wexler D, Blum M. The pathological consequences of anaemia. Clin Lab Haematol 2001;23:16.[CrossRef][ISI][Medline]
54 Means RT Jr. Advances in the anemia of chronic disease. Int J Hematol 1999;70:712.[ISI][Medline]
55 Davis DA, Rinderknecht AS, Zoeteweij JP et al. Hypoxia induces lytic replication of Kaposi sarcoma-associated herpesvirus. Blood 2001; 97:324450.
56 Wright JF, Blanchette VS, Wang H et al. Characterization of platelet-reactive antibodies in children with varicella-associated acute immune thrombocytopenic purpura (ITP). Br J Haematol 1996;95:14552.[CrossRef][ISI][Medline]
![]()
CiteULike
Connotea
Del.icio.us What's this?
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||